상세 보기
초록
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set from the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCTTTGA (PB-2). This primer set was used to specifically detect P. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia spp., as well as bacteria such as Pseudomonas spp. and Erwinia spp. did not show any reaction with the primer set.
키워드
- 제목
- Development of an in Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae
- 저자
- Hee, Jong Kim; Youn, Sulee
- 발행일
- 2001
- 유형
- Article
- 권
- 39
- 호
- 1
- 페이지
- 56 ~ 61